0 votes
ago in MANITOBA CHAPTER OF UNION PARTY OF CANADA by (19.8k points)
Warren and David B. Bregman J. Biol. Chem. doi. jbc. Access the most updated version of this article at http:www.jbc.orgcontent When a correction for this article is posted Click here to choose from all of JBCs email alerts This article cites references, of which can be accessed free at http:www.jbc.orgcontent.full.htmlreflist Downloadedfromhttp: www.jbc.orgbyguestonSeptember, The biological importance of homologous recombination is underscored by the conservation of the RAD pathway from fungi to humans.The critical roles of the RAD group proteins in the early steps of recombination, the search for DNA homology and strand exchange, are now becoming apparent.The costs of publication of this article were defrayed in part by the payment of page charges.This article must therefore be hereby marked advertisement in accordance   with U.These socalled RAD epistasis group genes include RAD, RAD, RAD, RAD, RAD, RAD, RAD, MRE, and XRS. Mutations in any of these genes result in ionizing radiationsensitive phenotypes.It is clear that the RAD homologous recombination pathway is functionally conserved from fungi to mammals.The sequence of all DNA fragments produced by polymerase chain reaction was confirmed by sequence analysis.For expression in mouse ES cells, the cDNA was placed under control of the phosphoglycerate kinase promoter.The disrupted mRAD alleles in this line contain the neomycin and puromycinselectable markers, respectively.The constructs were coelectroporated with a plasmid carrying the hygromycinselectable marker.The sensitivity of ES cells to increasing doses of ionizing radiation and mitomycin C was determined by measuring their colonyforming ability.Two days postinfection, cells were collected by low speed centrifugation and washed twice with icecold phosphatebuffered saline.Background hydrolysis observed in the absence of protein was subtracted.The sequence of the three oligonucleotides used was as follows: oligonucleotide a, CCAAGCTTGCATGCCTGCAGGTCGACTCTAGAGGA; oligonucleotide b, TTTGCTGCCGGTCACCCAAGCTTGCATGCCTGCAGGTCGACTCTAGAGGA; and oligonucleotide c, CCAAGCTTGCATGCCTGCAGGTCGACTCTAGAGGAAGGGGCCCATGGCTC.Annealing of oligonucleotide a resulted in a bp duplex, whereas annealing of oligonucleotidesbandcresulted in nucleotide overhangs, either or, in addition to the bp duplex region.This procedure resulted in incorporation of radiolabel in one of the two strands, indicated by the underlined nucleotide in italics; CCGGGTCTGGCGAGATGGTCAAAAGAAGACTTGCTATATCTACCGCCTGCTGTCTGCAGGGACCATTGAGGAGAAGATC.Branched dsDNA substrates were made by annealing three partially complementary oligonucleotides.The arms of the branched structure were between and bp.The purification and annealing procedures were as described. Released radiolabeled phosphate was separated from nonhydrolyzed ATP by thin layer chromatography, and the extent of hydrolysis was quantitated. In the absence of DNA, no significant hydrolysis of input ATP was observed.The <a href="http://inhibit09.online/archives/219"></a> amount of ATP in the reaction mixture at time was nmol.In addition to dsDNA, divalent cations were found to be essential for ATP hydrolysis.A number of independent cell lines were identified that expressed either tagged wildtype or mutant protein.Expression levels, which did not vary much between the different clones, ranged from onehalf to twice the level found in wildtype ES cells.One of those functions could be in contributing to the formation of multiprotein complexes.The absence of one of the components of such complexes might be more detrimental than the presence of a crippled component.For example, the absence of one of the components of the ERCCXPF structurespecific endonuclease causes instability of the other component. Because genetic and physical interactions have been detected among many of the RAD group genes and proteins, it is likely that these proteins function in the context of complex protein machines.

Please log in or register to answer this question.

Union Party Of Canada
...